Praca z plikami tekstowymi w linii komend

Praca z plikami tekstowymi w linii komend

Dlaczego to takie ważne?

Jak już wspominałem, praca bioinformatyka to w dużej mierze, o ile nie przede wszystkim praca z plikami tekstowymi. W poprzedniej lekcji pokazałem jak umieścić tekst w pliku przy pomocy operatorów > oraz >> a także jak wyświetlić zawartość pliku używając komend more, less i cat. Linux oferuje jednak znacznie więcej narzędzi pozwalających na efektywną pracę z plikami tekstowymi bez uciekania się do pomocy edytorów tekstu (na które też przyjdzie pora). Poniżej pokażę wybrane możliwości niektórych z nich. Warto jednak samodzielnie poszerzyć wiedzę na ten temat, ponieważ potrafią znacznie usprawnić i przyspieszyć pracę.
W terminalu utwórz katalog Pliki_tekstowe i wejdź do niego. Używając polecenia curl lub wget pobierz plik:

Liczenie zawartości i wyświetlanie części pliku - polecenia wc, head, tail.

Wykonaj polecenie:
$: wc Orobanchaceae-trnL-trnF-aligned.fasta
18 18 9254 Orobanchaceae-trnL-trnF-aligned.fasta
Komenda wc wyświetla liczbę linii, słów oraz wielkość liczoną w bajtach podanego pliku. Podając odpowiednie flagi, można uzyskać tylko wybrane dane (sprawdź wc --help), co później wykorzystamy. W przypadku pobranego pliku liczba linii i słów jest taka sama (18) ponieważ w opisach i sekwencjach nie występują spacje a sekwencje zostały umieszczone każda w jednej linii. Sprawdź zatem inny plik:
Zawiera on dopasowane sekwencje zapisane w formacie CLUSTAL. Zobacz jaka jest zawartość pliku a następnie sprawdź ile ma linii i słów.
Polecenie wc może odczytywać dane z wielu plików jednocześnie:
$: wc *
233 490 17672 Orobanchaceae-trnL-trnF-aligned.aln
18 18 9254 Orobanchaceae-trnL-trnF-aligned.fasta
251 508 26926 razem
Nie zawsze konieczne jest przeglądanie całego pliku. Czasem chcemy po prostu zobaczyć jak wygląda jego początek i koniec. Wtedy przychodzą nam z pomocą polecenia head i tail, które jak łatwo zgadnąć wyświetlają odpowiednio początek i koniec pliku:
$: head Orobanchaceae-trnL-trnF-aligned.aln
CLUSTAL 2.1 multiple sequence alignment
$: tail Orobanchaceae-trnL-trnF-aligned.aln
KY484464_O._teucrii AAATG
KY484493_O._flava AAATG
KY484489_O._mayeri AAATG
KY484471_O._kochii AAATG
KY484474_O._elatior AAATG
KU238865_O._coerulescens GAATG
KY484502_P._ramosa GAATG
KY484503_P._purpurea GAATG
KX524675_Lindenbergia_siniaca GAATG
Liczbę wyświetlanych linii można dostosować używając flagi -n:
$: head -n 5 Orobanchaceae-trnL-trnF-aligned.aln
CLUSTAL 2.1 multiple sequence alignment
$: tail -n 5 Orobanchaceae-trnL-trnF-aligned.aln
KU238865_O._coerulescens GAATG
KY484502_P._ramosa GAATG
KY484503_P._purpurea GAATG
KX524675_Lindenbergia_siniaca GAATG

grep - wyszukiwanie w pliku tekstowym

Narzędzie grep z pewnością należy do najbardziej użytecznych programów do pracy z plikami tekstowymi. Służy do wynajdywania w plikach danego ciągu znaków.
W katalogu z pobranymi (patrz wyżej) plikami wykonaj polecenie:
$: grep Lindenbergia Orobanchaceae-trnL-trnF-aligned.fasta
W podanym pliku został znaleziony ciąg znaków Lindenbergia a następnie linia w którym się znajdował została wyświetlona. Jeśli znaleziony fragment nie wyświetla się w innym kolorze niż pozostała część linii to można to uzyskać podając opcję --color=AUTO, np. grep --color=AUTO Lindenbergia Orobanchaceae-trnL-trnF-aligned.fasta.
Można przeszukać od razu wiele plików np. używając znaków wieloznacznych, uzyskamy także informację w jakim pliku znaleziono dopasowanie:
$: grep Lindenbergia *
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca AGTGATAAC-TTTCAAATTCAGAGAAACCCCGGAATTAAAAAAGG-GGGC
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca AATCCTGAGCCAAATCCTGT-----TTTCTCAAAACAAA-G--------A
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca C-AAAAATAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAAC---
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca -AAATGGAGTTGATTGCGCCGGTAGAGGAATCTTTCCATCGAAACTTCGG
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca AAAGGATGAAGGATAAACGTATCTATTGAATACTATATCAAATTATTAAT
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca GATATCAAATTATTAATGATGGCCCGAATCTGTATCTGTATTTTT---TA
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca ATTTTAATATGAAAAATGGAAAAGTTAGTGTGAATTGATTCCATATTGAA
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca GAAAGAATCGAATATTCATT-------CATCAAATCATTCACTCCACAGT
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca CCGATAGATC-----TTTTAAAGAATTGATTAATCGGATGAGAATAAAGA
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca TAGAGTCCCATTC----------TACATGTCAATACCGGCAACAATGAAA
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca TTTATAGTAAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTCAAG
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca TCCCTCTATCCCCAA---AAAAAGTCTATTTTACTTCCA-----------
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca -----------AAATATTTAGCCTATTTCA-----------------TTT
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca TCG-TTAGCGGTTCCAAATTCCTT--TTCTGATTC--TTTGACA--AACG
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca TATTGGGGCGT------------------AAATGACTTT-CTCTTATCAC
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca ATGTG------ATATAGAATACACATCCAAATTCAGCAAGGAATTCCTAT
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca TTGAATG------ATTCAGAATCAATAACATTACTC-AT-ACTGAAACTT
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca AGA---AAGTTCGTCTTTTTGAAGATCCAATAAATTACAGGATTTGGAGA
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca AAACTTTGTAATCTTCCCCA--TCCCTTTAATTGACATAGAGCCCAGTC-
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca ---ATCTAAT--AAAATCA------GGATGGGAATGGGATTATACATTGG
Orobanchaceae-trnL-trnF-aligned.aln:KX524675_Lindenbergia_siniaca GAATG
Jeśli chcemy przeszukać pliki w danym katalogu, należy użyć opcji -r, np.: grep -r Lindenbergia SEKWENCJE.
Narzędzia grep można użyć na przykład do sprawdzenia ile sekwencji znajduje się w pliku fasta. W tym celu należy znaleźć i policzyć linie zawierające znak >. Tu jednak czyha pewna pułapka. Najbardziej oczywistą komendą wydaje się: grep > Orobanchaceae-trnL-trnF-aligned.fasta ale jej wynik będzie taki:
$: grep > Orobanchaceae-trnL-trnF-aligned.fasta
Składnia: grep [OPCJA]... WZORZEC [PLIK] ...
Napisz „grep --help” żeby dowiedzieć się więcej.
Po pierwsze polecenie ewidentnie nie zrobiło tego czego po nim oczekiwaliśmy a po drugie jeśli teraz spróbujemy wyświetlić zawartość pliku Orobanchaceae-trnL-trnF-aligned.fasta to okaże się, że jest pusty. Dlaczego?
Przypomnijmy sobie, że operator > służy do przekazania tekstu do pliku. Zatem polecenie grep > Orobanchaceae-trnL-trnF-aligned.fasta uruchomiło polecenie grep (z nieprawidłową składnią) a wynik jego działania zapisało w pliku, w którym chcieliśmy szukać znaków >, wymazując jego poprzednią zawartość. Jest to bardzo łatwy do popełnienia błąd, który może się skończyć utratą wyników pracy! Jak więc należy prawidłowo wyszukać znaku >? Umieszczając go w cudzysłowach:
$: grep ">" Orobanchaceae-trnL-trnF-aligned.fasta
Zadanie: Zastanów się, co trzeba zrobić, żeby uzyskać nazwy sekwencji w osobnym pliku?
No dobrze, teraz możemy policzyć wyświetlone linie ale wolelibyśmy, żeby komputer sam je policzył. Co prawda istnieje odpowiednia opcja programu grep, która to robi (znajdź ją), ale jest to dobra okazja, żeby pokazać w jaki sposób można połączyć różne polecenia tak aby wykonały razem zadanie.

Potoki, czyli łączymy polecenia.

Chcemy policzyć linie, w których znajduje się znak >. Mamy do dyspozycji jedno narzędzie, które wyszukuje odpowiednie linie (grep) i drugie, które liczy linie (wc). Trzeba je zatem odpowiednio połączyć w jeden ,,taśmociąg''. Wykorzystamy do tego potoki (ang. pipe) - wynik działania grep (strumień) zostanie skierowany do wc. Do łączenia w ten sposób poleceń służy operator |. Polecenia wc użyjemy z flagą -l, która zwraca liczbę linii.
$: grep ">" Orobanchaceae-trnL-trnF-aligned.fasta | wc -l
Wiemy, że w pliku mamy 9 sekwencji.
Teraz poznamy kolejną opcję -v, która pozwala ,,odwrócić'' dopasowanie, czyli zwrócić linie, w których nie występuje dopasowanie i połączymy dwa polecenia grep tak, aby uzyskać listę próbek, które nie zawierają ciągu ,,Lindenbergia'':
$: grep -v Lindenbergia Orobanchaceae-trnL-trnF-aligned.fasta | grep ">"
Jak widać, w drugim wywołaniu plecenia grep nie podaliśmy nazwy pliku, tekst do przeanalizowania został przekazany za pomocą potoku.
Wynik możemy przekazać dalej, na przykład do polecenia sort, które jak nazwa wskazuje sortuje linie tekstu:
$: grep -v Lindenbergia Orobanchaceae-trnL-trnF-aligned.fasta | grep ">" | sort
Można oczywiście uzyskaną posortowaną listę nazw sekwencji do pliku:
$: grep -v Lindenbergia Orobanchaceae-trnL-trnF-aligned.fasta | grep ">" | sort > posortowane.txt
Wykonaj powyższe polecenie i sprawdź zawartość pliku posortowane.txt.

xargs - przekazanie argumentów do kolejnego polecenia

Narzędzie xargs pozwala przekazać kolejnemu poleceniu argumenty otrzymane ze standardowego wejścia, czyli np. przez potok. Najłatwiej pokazać to na przykładzie:
ls *.fasta | xargs cat > wszystkie.fasta
Najpierw mamy polecenie ls *fasta, które zwraca listę plików o przedłużeniu fasta znajdujących się w bieżącym katalogu. Jest ona przekazywana przez potok do polecenia xargs, które przekazuje je poleceniu cat jako kolejne argumenty. Jak wiemy polecenie cat zwraca zawartość pliku, którego nazwa jest argumentem do standardowego wyjścia, którym może być ekran, ale w tym przypadku, przekierowujemy ją do pliku wszystkie.fasta. Tak więc całe polecenie umieszcza zawartość wszystkich plików fasta w pliku wynikowym. W tym przypadku można by było po prostu wykonać komendę:
cat *.fasta > wszystkie.fasta
ale jak się później przekonamy, nie zawsze tak łatwo jest pominąć xargs i program ten bywa bardzo pożyteczny.

sed - przetwarzanie tekstu

Kolejne bardzo użyteczne narzędzie to sed. Pozwala na edycję strumienia danych. Jedną z zalet używania tego typu programów jest możliwość uzyskiwania i modyfikacji danych z plików bez konieczności ich otwierania od razu w całości, jak to ma miejsce w edytorach tekstu. Nie mam to wielkiego znaczenia w przypadku niewielkich plików ale na przykład pliki uzyskiwane przy sekwencjonowaniu genomów mogą mieć wielkość wielu gigabajtów co w znacznym stopniu utrudnia pracę nad nimi w edytorach tekstu. Nawet jednak dla małych plików praca z linii komend może być po prostu znacznie szybsza.
Prosty schemat użycia sed wygląda tak:
sed 's/szukany/zmieniony/g' plik
W pliku plik zmieniane są wszystkie ciągi znaków szukany na zmieniony. Bez opcji g (po trzecim ukośniku) zmienione zostanie tylko pierwsze wystąpienie szukanego ciągu w linii. Zamiast pliku można użyć strumienia danych z innych poleceń.
$: echo "ATCTTGGATCG" | sed 's/T/U/g'
Kilka przykładów, wykorzystamy utworzony powyżej plik posortowane.txt, najpierw sprawdźmy co zawiera:
$: more posortowane.txt
Zamiana znaków '_' na spacje:
sed 's/_/ /g' posortowane.txt
>KU238865 O. coerulescens
>KY484464 O. teucrii
>KY484471 O. kochii
>KY484474 O. elatior
>KY484489 O. mayeri
>KY484493 O. flava
>KY484502 P. ramosa
>KY484503 P. purpurea
Usuwane znaku >, ponieważ występuje on tylko raz w linii, opcja g jest zbędna:
sed 's/>//' posortowane.txt
Połączmy teraz dwa powyższe i zmieńmy skróty P. oraz O. na pełne nazwy rodzajowe:
$: sed 's/>//' posortowane.txt | sed 's/_/ /g' | sed 's/O\./Orobanche/' | sed 's/P\./Phelipanche/'
KU238865 Orobanche coerulescens
KY484464 Orobanche teucrii
KY484471 Orobanche kochii
KY484474 Orobanche elatior
KY484489 Orobanche mayeri
KY484493 Orobanche flava
KY484502 Phelipanche ramosa
KY484503 Phelipanche purpurea
Zauważ, że zamiast napisać s/O./Orobanche/ napisałem s/O\./Orobanche/. Co prawda w tym przypadku oba warianty zwrócą taki sam wynik, ale sposób ich działania jest nieco odmienny, o czym za chwilę.
Wynik działania sed często chcemy zapisać w pliku. Można w tym celu użyć znaku >:
$: sed 's/>//' posortowane.txt | sed 's/_/ /g' | sed 's/O\./Orobanche/' | sed 's/P\./Phelipanche/' > zmieniony.txt
Teraz można wykonać polecenie:
$: mv zmieniony.txt posortowane.txt
Jeśli chcemy bezpośrednio zmienić plik oryginalny, należy użyć opcji -i ale wtedy nie użyjemy potoków, możemy natomiast zgrupować formuły zmian razem oddzielając je średnikami (jeśli to nie działa spróbuj dodać opcję -e):
sed -i 's/>//;s/_/ /g;s/O\./Orobanche/;s/P\./Phelipanche/' posortowane.txt
Można też wykonać kolejno operacje:
$: sed -i 's/>//' posortowane.txt
$: sed -i 's/_/ /g' posortowane.txt
$: sed -i 's/O\./Orobanche/' posortowane.txt
$: sed -i 's/P\./Phelipanche/' posortowane.txt
Należy uważać ze zmianą oryginalnego pliku, lepiej najpierw sprawdzić czy wpisywana formuła edycji działa prawidłowo a dopiero później użyć opcji -i.

Wyrażenia regularne

Wyrażenia regularne są bardzo użyteczne w bioinformatyce, ponieważ są potężnym narzędziem ułatwiającym pracę z plikami tekstowymi i strumieniami tekstu czy ogólniej z ciągami znaków. Dzięki nim można opisać z różnym stopniem ogólności ciągi znaków, czy ich kategorie aby później je wyświetlić, usunąć czy zmodyfikować. Wykorzystuje się je w takich narzędziach jak grep, sed i wielu innych z dobrymi edytorami tekstu włącznie (np. vim).
Przyjrzyjmy się ponownie zmodyfikowanemu plikowi posortowane.txt.
$: more posortowane.txt
KU238865 Orobanche coerulescens
KY484464 Orobanche teucrii
KY484471 Orobanche kochii
KY484474 Orobanche elatior
KY484489 Orobanche mayeri
KY484493 Orobanche flava
KY484502 Phelipanche ramosa
KY484503 Phelipanche purpurea
Przypuśćmy, że chcemy uzyskać jedynie listę organizmów, bez numerów GenBank-u. Można by je po kolei usuwać, ale znaczne wygodniej będzie użyć wyrażeń regularnych:
$: sed 's/^[[:alnum:]]\+[[:space:]]//' posortowane.txt
Orobanche coerulescens
Orobanche teucrii
Orobanche kochii
Orobanche elatior
Orobanche mayeri
Orobanche flava
Phelipanche ramosa
Phelipanche purpurea
Zanim wyjaśnię jak i dlaczego to działa, trochę teorii.
W wyrażeniach regularnych możemy stosować znaki rozumiane dosłownie (litery, cyfry, spacje, niektóre inne znaki) oraz znaki specjalne ($, *, ., [, \, oraz ^)i wyrażenia, które pozwalają na przykład opisać kategorie znaków, ich liczbę, położenie itp. Na przykład ATG oznacza ciąg ATG ale [ATG] oznacza A lub T lub G. Specjalne znaczenie ma znak \, który zmienia znaczenie następnego znaku - na przykład oznacza, że następujący po nim znak specjalny powinien być rozumiany dosłownie albo, że zwykły znak ma znaczenie specjalne.
W poniższej tabeli znajdują się niektóre przykłady:
Znaczenie przykładu
zero lub więcej wystąpień wyrażenia
zero lub więcej liter T
jedno lub więcej wystąpień wyrażenia
jedna lub więcej litera T
zero lub jedno wystąpień wyrażenia
zero lub jedna litera T
dokładnie i wystąpień wyrażenia
trzy znaki T
pomiędzy i a j wystąpień wyrażenia
pomiędzy 3 a 5 znaków T
i lub więcej wystąpień wyrażenia
przynajmniej 3 znaki T
jakikolwiek znak
trzy dowolne znaki
początek linii
znak T występujący na początku linii
koniec linii
znak T na końcu linii
jakikolwiek znak z zestawu znaków
T lub G lub A
jakikolwiek znak z zakresu x do y (litery, cyfry)
duża litera
[a-z 0-9]
mała litera lub cyfra
jakikolwiek znak z poza zestawu znaków
jakikolwiek znak oprócz T, G i A
znak specjalny ($, *, ., [, \, ^) rozumiany dosłownie
znak ^ (a nie początek linii)
wyrażenie grupujące, dopasowany łańcuch można później wykorzystać, np. wstawiając go w inne miejsce
znak nowej linii
znak tabulatora
znak alfanumeryczny (litery lub cyfry)
Zauważ, że znaczenie znaku ^ zmienia się w zależności od kontekstu - oznacza on początek linii lub negację zakresu znaków.
Wróćmy teraz do pliku posortowane.txt i zastanówmy się jak można opisać numery GenBank-u?
$: more posortowane.txt
KU238865 Orobanche coerulescens
KY484464 Orobanche teucrii
KY484471 Orobanche kochii
KY484474 Orobanche elatior
KY484489 Orobanche mayeri
KY484493 Orobanche flava
KY484502 Phelipanche ramosa
KY484503 Phelipanche purpurea
Jest to ciąg znaków zaczynający się na początku linii, zawierający litery i cyfry (znali alfanumeryczne) po którym występuje spacja (jeden ze znaków odstępu).
Teraz poprzednio użyte wyrażenie powinno być bardziej zrozumiałe:
$: sed 's/^[[:alnum:]]\+[[:space:]]//' posortowane.txt
^ początek linii [[:alnum:]]\+ jeden lub więcej znaków alfanumerycznych [[:space:]] znak odstępu.
Zadanie: Spróbuj usunąć numery GenBank-u używając innego wyrażenia.
Po przejrzeniu powyższej tabeli powinno być jasne, dlaczego powyżej zamiast napisać s/O./Orobanche/ napisałem s/O\./Orobanche/. Kropka oznacza jakikolwiek znak, ponieważ także oznacza kropkę oba wyrażenia zadziałają w tym przypadku (!) tak samo, ale jeśli chcemy być pewni, że dopasujemy znak ., to powinniśmy użyć przed niem znaku \, co spowoduje, że znak zostanie odczytany dosłownie.
Zamieszczone w tabeli wyrażenie \(wyrażenie\) zapewne wydaje się niejasne. Pokażę zatem na przykładzie jak może być wykorzystane. Tym razem zadaniem będzie przeniesienie numeru GenBank-u na koniec linii. Można to zrobić tak:
$: sed 's/^\([[:alnum:]]\+[[:space:]]\)\(.*\)/\2 \1/' posortowane.txt
Orobanche coerulescens KU238865
Orobanche teucrii KY484464
Orobanche kochii KY484471
Orobanche elatior KY484474
Orobanche mayeri KY484489
Orobanche flava KY484493
Phelipanche ramosa KY484502
Phelipanche purpurea KY484503
Powyżej wykorzystałem dwa wyrażenia grupujące. Pierwszy z nich obejmuje dopasowanie numeru GenBank-u (oraz spację), drugie pozostałą część tekstu (.* oznacza zero lub więcej dowolnych znaków. Po drugim ukośniku odwołuję się do wcześniej znalezionych dopasowań: \1 oznacza pierwsze dopasowanie, \2 drugie dopasowanie. Umieszczając je w kolejności \2 \1 umieściłem pierwsze dopasowanie po drugim.
Zamianę można ograniczyć do linii, w których znajduje się inne dopasowanie. Na przykład:
$: sed "/^>/ s/A/0/g" plik.fasta
Zamieni znaki A na 0 w liniach, które zaczynają się od >.
Z kolei polecenie:
$: sed "/^>/! s/A/0/g" plik.fasta
Dokona zamiany w liniach, które nie rozpoczynają się od >.
Jeśli przed s w poleceniu umieścimy liczbę, będzie się ono odnosiło do linii w pliku o podanym numerze. Możemy np. w ten sposób dodać tekst w pierwszej linii w pliku plik.txt:
sed -i "1s/^/Tytuł dzieła\n/" plik.txt
Aby usunąć linie, w których znajduje się dany wzorzec stosujemy następującą komendę:
sed '/wzorzec/d' plik
Na przykład poniższa komenda usunie wszystkie linie z opisami sekwencji z pliku sekwencje.fasta
sed -i '/^>/d' sekwencje.fasta

tr - zmiana i usuwanie znaków

Program tr ma podobne zastosowanie do sed-a, specjalizuje się jednak w zamianie pojedynczych znaków.
Używamy go w ten sposób:
tr opcje znaki1 znaki2
znaki1 - to zestaw znaków które zmieniamy znaki2 - to zestaw znaków na które zmieniamy
Pokażę to na kilku przykładach.
Zamiana * na -
$: echo "AGGC*TT" | tr "*" "-"
Usunięcie znaków -. Tak można łatwo usunąć z sekwencji znaki oznaczające indele.
$: echo "AG--GC-TT" | tr -d "-"
Zamiana A na T, C na G, G na C oraz T na A.
$: echo "AGGCTT" | tr "ACGT" "TGCA"
W ten sposób można otrzymać łatwo sekwencję komplementarną. Zauważ, że powyższa komenda nie zmienia sekwencji ACGT na TGCA, ale podmienia poszczególne znaki.
tr nie ma możliwości bezpośredniej modyfikacji pliku, dlatego jeśli chcemy zmienić plik, użyjemy znaków przekierowania < do pliku wejściowego i > dla pliku wyjściowego.
Utwórz plik sekwencje.txt o zawartości:
Teraz utworzymy dla tych krótkich sekwencji sekwencje komplementarne:
tr "ACGT" "TGCA" < sekwencje.txt > sekwencje_komplementarne.txt
cat sekwencje.txt | tr "ACGT" "TGCA" > sekwencje_komplementarne.txt
Otrzymujemy plik sekwencje_komplementarne.txt:
Teraz połączmy te sekwencje w jedną, długą. W tym celu usuniemy \n oznaczający znak nowej linii.
tr -d "\n" < sekwencje_komplementarne.txt > polaczona_sekwencja_komplementarna.txt
Tu też oczywiście można też użyć komendy cat i znaku |:
cat sekwencje_komplementarne.txt| tr -d "\n" > polaczona_sekwencja_komplementarna.txt
Plik wynikowy, zgodnie z założeniem, posiada jedną długą sekwencję:

rev - odwracanie łańcucha znaków

Bardzo prostym, ale użytecznym narzędziem jest rev (od reverse), który odwraca łańcuch znaków.
$: echo "ACGTTT" | rev
Teraz można sekwencję w pliku polaczona_sekwencja_komplementarna.txt także odwrócić. W efekcie otrzymamy sekwencję komplementarną, odwróconą.
cat polaczona_sekwencja_komplementarna.txt | rev > polaczona_sekwencja_komplementarna_odwrocona.txt
Cały proces łączenia przekształcania sekwencji w odwróconą i komplementarną można zmieścić w ,,jednolinijkowcu'' używając potoków i przekierowania:
cat sekwencja.txt | tr "ACGT" "TGCA" | tr -d "\n" | rev > sekwencja_RC.txt

uniq - usuwanie powtórzeń

Polecenie uniq pozwala na usuwanie powtarzających się linii. Na przykład chcielibyśmy otrzymać listę rodzajów z taksonów znajdujących się w pliku fasta ale tak, aby każda nazwa występowała tylko raz.
Pobierz plik:
Najpierw uzyskajmy opisy sekwencji:
$: grep ">" atp6-samples.fasta
>KY492922.1 Dendropicos elliotii isolate DA07 ATP6 (ATP6) gene, partial cds; mitochondrial
>KY492921.1 Dendropicos stierlingi isolate ZMUC74329 ATP6 (ATP6) gene, complete cds; mitochondrial
>KY492920.1 Dendropicos poecilolaemus isolate ZMUC72915 ATP6 (ATP6) gene, complete cds; mitochondrial
>KY492919.1 Campethera punctuligera isolate ZMUC56174 ATP6 (ATP6) gene, complete cds; mitochondrial
>KY492918.1 Campethera cailliautii isolate ZMUC56172 ATP6 (ATP6) gene, complete cds; mitochondrial
>KY492917.1 Dendropicos fuscescens isolate Z34 ATP6 (ATP6) gene, complete cds; mitochondrial
>KY492916.1 Campethera cailliautii isolate W45 ATP6 (ATP6) gene, complete cds; mitochondrial
>KY492915.1 Chloropicus xantholophus isolate MNHN2005922 ATP6 (ATP6) gene, complete cds; mitochondrial
Jak widać opisy są nieco bardziej złożone niż w poprzednio używanym pliku, ponadto jest ich więcej (powyżej widać tylko początek listy).
Teraz trzeba wyodrębnić nazwy rodzajowe. W naszym pliku jest to drugi ciąg znaków alfanumerycznych. Zastanów się jak go uzyskać?
$: grep ">" atp6-samples.fasta | sed 's/\(^>[[:alnum:]]\+\.[[:digit:]][[:space:]]\)\([[:alnum:]]\+\)\([[:space:]].\+\)/\2/'
Tym razem wykorzystałem trzy wyrażenia grupujące: pierwszy oznacza numer GenBank-u (znali alfanumeryczne, kropka, cyfra) ze spacją, drugi znajduje ciąg znaków alfanumerycznych odpowiadających nazwie rodzajowej a trzeci grupuje pozostałe znaki w linii. Jak widać wykorzystujemy w dalszej części polecenia tylko drugie dopasowanie co powoduje, że zwracana jest tylko nazwa rodzajowa. Szkopuł w tym, że nazwy te wyświetlają się wielokrotnie, a chcielibyśmy mieć listę rodzajów, taką w której każda występowałaby tylko raz. Dodajmy zatem polecenie uniq:
$: grep ">" atp6-samples.fasta | sed 's/\(^>[[:alnum:]]\+\.[[:digit:]][[:space:]]\)\([[:alnum:]]\+\)\([[:space:]].\+\)/\2/' | uniq
Efekt jest nie do końca zgodny z oczekiwaniami. Co prawda duplikaty zostały usunięte, ale tylko wtedy gdy znajdowały się bezpośrednio po sobie. Tak właśnie działa uniq. Wykorzystajmy zatem polecenie, które sortuje linie, czyli sort wtedy wszystkie takie same linie znajdą się bezpośrednio przy sobie.
$: grep ">" atp6-samples.fasta | sed 's/\(^>[[:alnum:]]\+\.[[:digit:]][[:space:]]\)\([[:alnum:]]\+\)\([[:space:]].\+\)/\2/' | sort | uniq
Zadanie: policz ile sekwencji i ile różnych nazw rodzajowych znajduje się w pliku